< návrat zpět

MS Excel


Téma: jak spočítat znaky rss

Zaslal/a 11.1.2011 8:52

Prosím o radu, jak mám v excelovském souboru zjistit celkový počet znaků. Žádné okénko s počtem slov, jak se najde u Wordu, jsem neobjevila, a nápověda také mlčí. Může mi s tím někdo pomoci?

Zaslat odpověď >

#003724
avatar
napadá mě řešení makrem:

Sub počet()
Dim oblast, bunka As Range
Dim pocet As Byte
Set oblast = Range("A1:G50")
pocet = 0
For Each bunka In oblast
pocet = pocet + Len(bunka)
Next bunka
MsgBox pocet
End Sub


jako oblast si zvol bunky kde máš text
Příloha: rar3724_pocet_znaku.rar (16kB, staženo 25x)
citovat
#003733
avatar
Zajímavé řešení, já bych to pro součet konstant upravil takto (ne vzorců):

Cells.SpecialCells(xlCellTypeConstants, 7).Select
For Each bunka In Selection
pocet = pocet + Len(bunka)
Next bunka
MsgBox pocet

citovat
#018584
avatar
Staci skopirovat tabulku a vlozit do Wordu a zistis to uplne rovnako :Dcitovat
#018588
avatar
Pro list lze použít maticový vzorec:

=suma(délka(oblast))

vkládá se trojhmatem (ctrl-shift-enter)

Nedoporučuji zadávat celý list, vyberte příslušnou oblast.citovat
#045190
avatar
CTTCAAGCCCCTGAGCAAAA
ATACGTGGGCTTGTGTCTCC
CAAGAGTCCTCTGGCTTTGG
TGCTGTCTCCTTTCCTTTGC
TAAGCTGAAGAAGGGCCTCA
TCCCCTGCAGTGTTTGTGTAcitovat
#045192
elninoslov
No a čo my tu s tým DNA máme robiť ?citovat

Uživatelské menu

Nejste přihlášen(a)
avatar\n

Menu

On-line nástroje

Formulář Faktura

Formulář Faktura III

Oblíbený formulář Faktura byl vylepšen a rozšířen. Formulář faktura III
Více se dočtete zde.

Aktivní diskuse

Textová funkce

Marecek • 24.1. 1:03

Textová funkce

marjankaj • 24.1. 0:41

Závislost mezi zaškrtávacími políčky

Marecek • 23.1. 23:21

Textová funkce

Marecek • 23.1. 21:54

Outlooku – automatické ukládání přílohy

urbano • 23.1. 14:35

Podbarvení buňky z jiného listu

Marekh • 23.1. 14:14

Textová funkce

marjankaj • 23.1. 14:13